In vivo cloning of up to 16 kb plasmids in E. coli is as simple as PCR.

[JoaoAraujo0305]

Submitter 1 full name

João de Sousa Araújo

Submitter 1 ORCID

ORCID:0009-0002-1773-0491

Submitter 1 GitHub username

JoaoAraujo0305

Submitter 2 full name

No response

Submitter 2 ORCID

No response

Submitter 2 GitHub username

No response

Submitter 3 full name

No response

Submitter 3 ORCID

No response

Submitter 3 GitHub username

No response

PMID

PMID:28837659

Title

In vivo cloning of up to 16 kb plasmids in E. coli is as simple as PCR.

Cloning Detail Level

Cloning information completely missing

Plasmids and Alleles

We used a lot of different plasmids like pGLO, pUC19, pETite N-His Kan.
Then i tried to replicate these plasmids with the respective template, just like KanR for pETite N-His Kan.
The results were inconclusive as in the OpenCloning app i couldn't replicate the target plasmid with this error:
"No pair of annealing primers was found. Try changing the annealing settings."

Cloning Techniques Used

• Gibson Assembly
• Golden Gate
• Gateway Cloning
• CRISPR/Cas9
• Homologous Recombination
• Traditional Restriction Enzyme Cloning
• PCR Cloning
• Overlap Extension
• In-Fusion Cloning
• De-novo DNA synthesis
• Other (please specify in notes)

Cloning Text (if available)

PDF about the whole experience - https://journals.plos.org/plosone/article/file?id=10.1371/journal.pone.0183974&type=printable
Example of the DNA of the plasmid i tried to replicate - https://storage.googleapis.com/plos-corpus-prod/10.1371/journal.pone.0183974/1/pone.0183974.s005.pdf?X-Goog-Algorithm=GOOG4-RSA-SHA256&X-Goog-Credential=wombat-sa%40plos-prod.iam.gserviceaccount.com%2F20250411%2Fauto%2Fstorage%2Fgoog4_request&X-Goog-Date=20250411T150918Z&X-Goog-Expires=86400&X-Goog-SignedHeaders=host&X-Goog-Signature=33e2098569eced6f7652f551cca6c72453b21389cad7ca68e02e4c5b54b6922ed9a90e618c0a30605b464c27d7af7a5736c536e931af9460fdd269e7a79ffdb86474b6ebf72b87a086c3b907e9efa39f2eb68b88bc04bbc558a5c66239ac7e09c48a6ddf44938521d6dba75849cf584ca055ded66617e59020cea3b6e0df67a6cad8ef386960b495dcb6c4b1e9ec1c56a33bf6b2fed6055068c20cfa6db1be17211a12efbf702d21c5587bcd7c29c007089185d179f0f812e5d542e1900400ec9cec030418c73eca50b4919e1c57611e49a16ac3029420160072ba26615cc578982a29a9526de247be65dd16323f55d684ebaa51899011239ea5a19562dc8bc5
Sequence of primers used to get the target plasmid - https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0183974#sec015

Cloning Strategies

In vivo cloning of up to 16 kb plasmids in E. coli is as simple as PCR..json

Missing information (if any)

No response

Present information (if any)

No response

Assumptions

No response

Notes

No response

[manulera]

Hi @JoaoAraujo0305 thank you very much for your submission and for documenting your work with the relevant links!

I was able to reproduce the creation of pDSA from the information given in the paper:

Similarly, pDSA (S2 Sequence, 7037 bp) was assembled by 3 DNA fragments with 25-nt homologous ends. The 3 DNA fragments–F1 (5798 bp), F2 (976 bp), and F3 (341 bp)–were generated by PCR from the template plasmids pET28a-Ec.coaD, pET28a-Ec.coaA, and pETite N-His SUMO, respectively, using the primer pairs TAACTCCGTCGACAAGC/CGCTAACTTCGCCAT, ATGAGTATAAAAGAGCAAACG/tgcggccgcaagcttgtcgacggagttaTTTGCGTAGTCTGACCT, and tcaggcgctgatggcgaagttagcgCAGGACTCAGAAGTC/ttaacgtttgctcttttatactcatACCTCCAATCTGTTC. One of the isolated plasmid was used directly as the template for the construction of pDSADE.

• pET28a-Ec.coaD and pET28a-Ec.coaA are available from Addgene (found with google)
• pETite N-His SUMO is available from several sources, including SnapGene, that you can directly import from OpenCloning (link here https://www.snapgene.com/plasmids/lucigen_vectors/pETite_N-His_SUMO_Kan)

See the cloning strategy for pDSA here: pDSA.json - you can load that file in opencloning and see the cloning strategy.