[main_samview] specifies an unknown reference name. Continue anyway

[tomoosting]

Hi I'm getting the following error when trying to run ERDS

When running /erds_pipeline.pl I get the following error message:
[main_samview] region ":-9098-90901" specifies an unknown reference name. Continue anyway.
[main_samview] region ":-27703-72296" specifies an unknown reference name. Continue anyway.
[main_samview] region ":-20895-79104" specifies an unknown reference name. Continue anyway.
[main_samview] region ":-69505-30494" specifies an unknown reference name. Continue anyway.
[main_samview] region ":-26623-73376" specifies an unknown reference name. Continue anyway.
[main_samview] region ":-71501-28498" specifies an unknown reference name. Continue anyway.
[main_samview] region ":-85634-14365" specifies an unknown reference name. Continue anyway.
[main_samview] region ":-63919-36080" specifies an unknown reference name. Continue anyway.
[main_samview] region ":-19113-80886" specifies an unknown reference name. Continue anyway.
[main_samview] region ":-61066-38933" specifies an unknown reference name. Continue anyway.
[main_samview] region ":-93997-6002" specifies an unknown reference name. Continue anyway.
[main_samview] region ":-21534-78465" specifies an unknown reference name. Continue anyway.
[main_samview] region ":-33254-66745" specifies an unknown reference name. Continue anyway.
[main_samview] region ":-20891-79108" specifies an unknown reference name. Continue anyway.
[main_samview] region ":-56495-43504" specifies an unknown reference name. Continue anyway.
[main_samview] region ":-55683-44316" specifies an unknown reference name. Continue anyway.
[main_samview] region ":-34919-65080" specifies an unknown reference name. Continue anyway.
[main_samview] region ":-25443-74556" specifies an unknown reference name. Continue anyway.
[main_samview] region ":-72529-27470" specifies an unknown reference name. Continue anyway.
[main_samview] region ":-7985-92014" specifies an unknown reference name. Continue anyway.
no enough reads

The assembly I'm using refers to the scaffolds in various ways i.e. LG1 to LG25 and scaffold_1223 etc..
From looking at the Perl script I think the error originates around line 309 which contains:
$samtools view -q 10 $bam_file $chr_ran:$start_ran-$end_ran|
it looks like no value gets allocated to $chr_ran which might have something to do with how it expects the scaffold/chromosome to be indicated.
Does the script expect the scaffolds of the assembly to be numbered from 1 to how many there are?
If so, is there a way to make the script run with "unconventional" scaffold names?

[cmatKhan]

I am having the same issue -- did you solve this by re-numbering the chromosomes? That is less than ideal -- it makes it difficult to include this in a pipeline. @bjtrost and @nickzren, is this repository unmaintained -- should I not expect there to be any updates to address chromosome names?

I am trying to run this on data from a pathogenic fungus, crytococcus neoformanns.

This is my command:

###########################ERDS1.1############################
Your input command line is
perl /opt/ERDS/src/erds_pipeline.pl -b /data/alignment/bwamem2/sample_21_bwamem2_sorted_markdups.bam -v /data/variant_annote/bwamem2/snpeff/sample_21_dusted.recode_sorted_sorted_snpEff.ann.vcf -o erds_output -r /ref/KN99_genome_fungidb.fasta -c 10 

And this is the problem, it seems:

[main_samview] region ":-46757-53242" specifies an unknown reference name. Continue anyway.
[main_samview] region ":-32825-67174" specifies an unknown reference name. Continue anyway.
[main_samview] region ":-95744-4255" specifies an unknown reference name. Continue anyway.
[main_samview] region ":-89130-10869" specifies an unknown reference name. Continue anyway.
[main_samview] region ":-24814-75185" specifies an unknown reference name. Continue anyway.
[main_samview] region ":-91924-8075" specifies an unknown reference name. Continue anyway.
[main_samview] region ":-70754-29245" specifies an unknown reference name. Continue anyway.
[main_samview] region ":-31687-68312" specifies an unknown reference name. Continue anyway.
[main_samview] region ":-28614-71385" specifies an unknown reference name. Continue anyway.
[main_samview] region ":-71513-28486" specifies an unknown reference name. Continue anyway.
[main_samview] region ":-79693-20306" specifies an unknown reference name. Continue anyway.
[main_samview] region ":-46888-53111" specifies an unknown reference name. Continue anyway.
[main_samview] region ":-69716-30283" specifies an unknown reference name. Continue anyway.
[main_samview] region ":-79910-20089" specifies an unknown reference name. Continue anyway.
[main_samview] region ":-22417-77582" specifies an unknown reference name. Continue anyway.
[main_samview] region ":-58024-41975" specifies an unknown reference name. Continue anyway.
[main_samview] region ":-53791-46208" specifies an unknown reference name. Continue anyway.
[main_samview] region ":-55215-44784" specifies an unknown reference name. Continue anyway.
[main_samview] region ":-80181-19818" specifies an unknown reference name. Continue anyway.
[main_samview] region ":-42186-57813" specifies an unknown reference name. Continue anyway.
no enough reads

This is what my reference looks like:

Singularity> head /ref/KN99_genome_fungidb.fasta
>CP022321.1 | organism=Cryptococcus_neoformans_var._grubii_KN99 | version=2018-11-08 | length=2291500 | SO=chromosome
GAATTCTAAAACAGTTGCATTCTATAATTACAAAATAATTGAAACACTTCCATTCTCTTG
ACTAATATTATTTAATTAGACACCAACTCGACATTCTGCCTTCGACCTATCTTTCTCCTC
TCCCAGTCATCGCCCAGTAGAATTACCAGGCAATGAACCAGGGCCTTCCATCCCAACGGC
ACAGCATATGGGTTCACTCCAACAGTGAACCATTCCAAAAGGCCTTGCCTGCGTGGCCAT
CTCCTCACAAACCCACCATCCCGCAACATCTCAGGTATCATACCTTCGATTCCTTCATCA
CCCCAAAAATCTTTCTGTTTGCCTTTGCGATTTGAGTGATACCAAACAAGAGAATACAGA
AAGTAAGGGACAAAGGGGGAGGGCTCTCTGAAGCGGCATGCTCCTCTTTCAACATTAAAA
TGGAAAGCCCCATCATCCATGTGGTATATGGGCAGCCAGCAAACCTTACAAACACCACTT
TTCAGATTTTCCAGAGCATCCAACCAGTCATCAATGTGATCGAGAGGAACCTTTTGACAC

The bam is generated using the same file:

Singularity> /opt/ERDS/src/software/samtools view -H /data/alignment/bwamem2/sample_21_bwamem2_sorted_markdups.bam
@HD	VN:1.6	SO:coordinate
@SQ	SN:CP022321.1	LN:2291500
@SQ	SN:CP022322.1	LN:1621676
@SQ	SN:CP022323.1	LN:1574972
@SQ	SN:CP022324.1	LN:1084805
@SQ	SN:CP022325.1	LN:1814975
@SQ	SN:CP022326.1	LN:1422463
@SQ	SN:CP022327.1	LN:1399209
@SQ	SN:CP022328.1	LN:1398693
@SQ	SN:CP022329.1	LN:1186813
@SQ	SN:CP022330.1	LN:1059962
@SQ	SN:CP022331.1	LN:1562107
@SQ	SN:CP022332.1	LN:774060
@SQ	SN:CP022333.1	LN:756017
@SQ	SN:CP022334.1	LN:942472
@SQ	SN:CP022335.1	LN:24923
@SQ	SN:NAT	LN:1650
@SQ	SN:G418	LN:2565
@RG	ID:sample_21	LB:1	PL:ILLUMINA	SM:sample_21	PU:6023
@PG	ID:bwa-mem2	PN:bwa-mem2	VN:2.2.1	CL:bwa-mem2 mem -t 8 ./bwamem2/KN99_genome_fungidb.fasta Brent_21_GTAC_21_SIC_Index2_09_CTCAATGATC_TGTGAGGT_S40_R1_001.fastq.gz Brent_21_GTAC_21_SIC_Index2_09_CTCAATGATC_TGTGAGGT_S40_R2_001.fastq.gz
@PG	ID:samtools	PN:samtools	PP:bwa-mem2	VN:1.15.1	CL:samtools view -@ 8 -o sample_21_bwamem2.bam -
@PG	ID:samtools.1	PN:samtools	PP:samtools	VN:1.15.1	CL:samtools sort -@ 6 -o sample_21_bwamem2_sorted.bam -T sample_21_bwamem2_sorted sample_21_tagged.bam
@PG	ID:MarkDuplicates	VN:Version:2.27.4-SNAPSHOT	CL:MarkDuplicates 
...

And the VCF file, generated by freebayes, was generated from the same bam:

...
##commandline="freebayes -f KN99_genome_fungidb.fasta --target KN99_genome_fungidb.fasta.bed -p 1 -F 0.75 --min-coverage 5 --min-mapping-quality 30 --min-base-quality 20 sample_21_bwamem2_sorted_markdups.bam"
##contig=<ID=CP022321.1,length=2291500>
##contig=<ID=CP022322.1,length=1621676>
##contig=<ID=CP022323.1,length=1574972>
##contig=<ID=CP022324.1,length=1084805>
##contig=<ID=CP022325.1,length=1814975>
##contig=<ID=CP022326.1,length=1422463>
##contig=<ID=CP022327.1,length=1399209>
##contig=<ID=CP022328.1,length=1398693>
##contig=<ID=CP022329.1,length=1186813>
##contig=<ID=CP022330.1,length=1059962>
##contig=<ID=CP022331.1,length=1562107>
##contig=<ID=CP022332.1,length=774060>
##contig=<ID=CP022333.1,length=756017>
##contig=<ID=CP022334.1,length=942472>
##contig=<ID=CP022335.1,length=24923>
##contig=<ID=NAT,length=1650>
##contig=<ID=G418,length=2565>
##fileDate=20220925
##phasing=none
##reference=KN99_genome_fungidb.fasta
...