LocalHGT is a software tool which
- can detect HGT breakpoints from shotgun metagenome data
- can detect complete HGT events including the transferred sequence and related deletion and insertion sites
- can handle a human gut microbiome sample with ~two hours and <25G memory using ten threads
There are three methods to install LocalHGT:
First, install LocalHGT by conda via the bioconda channel. It is recommended to create a new conda environment and install LocalHGT simultaneously.
conda create --name localhgt -c bioconda -c conda-forge localhgt
conda activate localhgt
or use mamba
mamba create --name localhgt -c bioconda -c conda-forge localhgt
mamba activate localhgt
Also, you can install LocalHGT in existing conda environment. Notably, conflicts may occur with existing packages in this way.
conda install bioconda::localhgt
Second, obtain the source code, construct the environment with conda, and then install
git clone https://github.com/deepomicslab/LocalHGT.git --depth 1
cd LocalHGT/
conda env create --name localhgt -f brief_env.yml
conda activate localhgt
sh install.sh
Third, obtain the source code from github, install the dependencies (listed at Dependencies), and then install.
Ensure your platform has c++ compiler (g++) and make.
If you have the root access, just install by:
make
python3 setup.py install
Otherwise, run
make
chmod 744 scripts/*
cd scripts && ln -s localhgt.py localhgt
Then add the full path of scripts/ to the system path by adding export PATH="/full-path-to/scripts/:$PATH" to .bashrc.
cd test/
sh run_BKP_detection.sh # test HGT breakpoint detection
sh run_event_detection.sh # test HGT event detection
See output/test_sample.acc.csv for breakpoint results, and see test_event_output.csv for event results.
After installation, perform LocalHGT with
localhgt --help
localhgt bkp --help
localhgt event --help
Note:
- If you meet any issues, take a look at Bug fix.
- LocalHGT only accepts paired-end shotgun metagenomic sequencing data.
- LocalHGT supports Linux and Windows WSL platforms.
usage: localhgt [-h] {bkp,event} ...
LocalHGT: an ultrafast HGT detection method from large microbial communities
optional arguments:
-h, --help show this help message and exit
Command:
{bkp,event}
bkp Detect HGT breakpoints from metagenomic sequencing data.
event Infer complete HGT events based on detected HGT breakpoints.
Note: To use LocalHGT, first detect HGT breakpoints with 'localhgt bkp'. After
that, detect HGT events based on the detected HGT breakpoints with 'localhgt
event'. Detailed documentation can be found at
https://github.com/deepomicslab/LocalHGT
LocalHGT requires a reference, and LocalHGT accepts the reference by parameter localhgt bkp -r; please give the full path of the reference to -r. The reference contains the representative genome of your interested microbes, and it should be a single fasta file.
We have prebuilt several references for users to conveniently use. It is recommended to choose a habitat-specific reference. For example, if you want to analyze the human oral microbiome, you can use human-oral-v1-0-1. The prebuilt references are:
If you cannot visit these links, please wait a while and try it again. The related annotation information can be obtained from MGnify.
Moreover, ProGenomes3 provides several representative genome sets. Please click the below link to download it, and then unzip it. Subsequently, pass its path to -r.
- all microbial representative genomes
- Aquatic
- Disease associated
- Food associated
- Freshwater
- Host associated
- Host plant associated
- Sediment mud
- Soil
Note:
- the reference file should be uncompressed.
- given a new reference,
LocalHGTwill index it automatically, and it will take a few hours (e.g., several hours for UHGG v1). - reference index file size is approx (reference size) * 4 * (number of hash functions), make sure the disk has enough space. The number of hash functions is defaulted by 3, and is denoted by the parameter
-e.
First, infer HGT breakpoints by running localhgt bkp like
usage: localhgt bkp [-r] [--fq1] [--fq2] [-s] [-o] [-k] [-t]
[-e] [-a] [-q] [--seed] [--use_kmer]
[--hit_ratio] [--match_ratio] [--max_peak]
[--sample] [--refine_fq] [--read_info] [-h]
Detect HGT breakpoints from metagenomic sequencing data. Example: localhgt bkp
-r reference.fa --fq1 test.1.fq --fq2 test.2.fq -s test -o outdir
required arguments:
-r <str> Uncompressed reference file, which contains all the
representative references of concerned bacteria. (default:
None)
--fq1 <str> Uncompressed fastq 1 file. (default: None)
--fq2 <str> Uncompressed fastq 2 file. (default: None)
-s <str> Sample name. (default: sample)
-o <str> Output folder. (default: ./)
optional arguments:
-k <int> kmer length. (default: 32)
-t <int> number of threads. (default: 10)
-e <int> number of hash functions (1-9). (default: 3)
-a <0/1> 1 indicates retain reads with XA tag. (default: 1)
-q <int> minimum read mapping quality in BAM. (default: 20)
--seed <int> seed to initialize a pseudorandom number generator.
(default: 1)
--use_kmer <1/0> 1 means using kmer to extract HGT-related segment, 0
means using original reference. (default: 1)
--hit_ratio <float> minimum fuzzy kmer match ratio to extract a
reference fragment. (default: 0.1)
--match_ratio <float> minimum exact kmer match ratio to extract a
reference fragment. (default: 0.08)
--max_peak <int> maximum candidate BKP count. (default: 300000000)
--sample <float> down-sample in kmer counting: (0-1) means sampling
proportion, (>1) means sampling base count (bp). (default:
2000000000)
--refine_fq <0/1> 1 indicates refine the input fastq file using fastp
(recommended). (default: 0)
--read_info <0/1> 1 indicates including reads info, 0 indicates not
(just for evaluation). (default: 1)
-h, --help
The detected HGT breakpoints are stored in the <sample name>.acc.csv file within the output folder. See how to interpret results.
Note:
- The fastq files should be uncompressed.
- With a small reference, we can skip extracting HGT-related segments by setting
--use_kmer 0. - With a small reference, while maintaining the extraction of HGT-related segments, we can set a small value of
-kto reduce memory usage.
Second, infer complete HGT events by running localhgt event like
usage: localhgt event [-r] [-b] [-f] [-n] [-m] [-h]
Infer complete HGT events based on detected HGT breakpoints. Example: localhgt
event -r reference.fa -b outdir -f test_event.csv
required arguments:
-r <str> <str> Uncompressed reference file, which contains all the
representative references of concerned bacteria. It should be
the same as the reference file used in localhgt bkp -r. (default: None)
-b <str> the folder stores all the breakpoint results from all
samples, i.e., a folder stores all the *acc.csv files generated
by 'localhgt bkp' (default: None)
-f <str> Output file to save all inferred HGT events. (default:
complete_HGT_event.csv)
optional arguments:
-n <int> minimum supporting split read number (default: 2)
-m <int> minimum transfer sequence length (default: 500)
-h, --help
Note:
- the reference file (given by
-r) should be the same as the reference file used inlocalhgt bkp(also given by-r). - It is recommended to detect HGT breakpoints for each sample and store the results in a common output folder. Subsequently, when detecting complete HGT events, specify the output folder using the
-bparameter. This approach allows LocalHGT to consider all the samples collectively, resulting in more reliable results for complete HGT events.
The HGT breakpoints are saved in the *acc.csv file. Here is an example:
# the number of reads in the sample is: 41723899; Insert size is 681.
from_ref,from_pos,from_side,from_strand,to_ref,to_pos,to_side,to_strand,if_reverse,read_seq,ref_seq,similarity,from_split_reads,to_split_reads,cross_split_reads,pair_end
GUT_GENOME000031_3,41994,head,+,GUT_GENOME096518_4,692224,tail,+,False,GTGTCGGGGCTTATGATAATCATATCTTATTTTTC,GTGTCGGGGCTTATGATAATCATATCTTTTTTTTC,1.857,3,2,2,5
GUT_GENOME096518_4,725079,head,+,GUT_GENOME000031_3,41992,tail,+,False,TACGCGGAGGGATTATGGGAATGCTCACGGCAATCGAAATGGGAA,CCCGCGGCGGGATTATGGGAATGCTCACGGCAATCGAAATGGGAA,1.8,1,3,1,5
Interpret each column as:
| Header | Description |
|---|---|
| from_ref | first genome ID |
| from_pos | first genome breakpoint position |
| from_side | first genome side |
| from_strand | first genome strand |
| to_ref | second genome ID |
| to_pos | second genome breakpoint position |
| to_side | second genome side |
| to_strand | second genome strand |
| if_reverse | if the transferred sequence is reversely inserted to recipient |
| read_seq | used reads sequence in local alignment |
| ref_seq | aligned reference sequence in local alignment |
| similarity | alignment similarity in local alignment |
| from_split_reads | number of split reads mapped to the from_pos |
| to_split_reads | number of split reads mapped to the to_pos |
| cross_split_reads | number of split reads supported the breakpoint pair |
| pair_end | number of paired-end reads supported the breakpoint pair |
Note:
- Before conducting the analysis, it is advisable to filter out any instances of gene transfer between different contigs of the same species that may be present in the results. For example, GUT_GENOME000031_1 and GUT_GENOME000031_2 belong to the same species, the detected HGT breakpoint pairs or HGT events between them should be discarded.
HGT event results are like
sample,receptor,insert_locus,donor,delete_start,delete_end,reverse_flag
species20_snp0,GUT_GENOME000149_2,369882,GUT_GENOME000537_12,40443,91965,True
species20_snp0,GUT_GENOME000189_7,22927,GUT_GENOME000534_3,78150,79127,True
species20_snp0,GUT_GENOME001261_3,336654,GUT_GENOME000202_1,72162,123917,False
Interpret each column as:
| Header | Description |
|---|---|
| sample | Sample ID |
| receptor | recipient genome |
| insert_locus | the transferred sequence is inserted at this locus of the recipient |
| donor | donor genome |
| delete_start | the start site of the transferred sequence on the donor genome |
| delete_end | the end site of the transferred sequence on the donor genome |
| reverse_flag | if the transferred sequence is reversely inserted into recipient |
python>=3.7.12
scikit-bio=0.5.6 (install this module will install scikit-learn, scipy, numpy, and pandas simultaneously)
networkx=2.6.3
typing-extensions>=4.11.0
biopython
pysam
pyfaidx
samtools>=1.11
bwa>=0.7.17
fastp>=0.23.2
seqkit>=2.6.1
make
cxx-compiler
The above tools should be installed in the system path. While the installation process using conda can be expedited by not specifying the version, it is important to note that this approach may potentially introduce unexpected bugs.
- If you meet
No module named _sysconfigdata_x86_64_conda_cos7_linux_gnu, according to the solution, just run
cp ${CONDA_PREFIX}/lib/python3.7/_sysconfigdata_x86_64_conda_cos6_linux_gnu.py ${CONDA_PREFIX}/lib/python3.7/_sysconfigdata_x86_64_conda_cos7_linux_gnu.py
- If you meet
cannot import name TypeAlias from typing_extensions, according to the solution, run
pip install typing-extensions --upgrade
- If you meet
ERROR: Could not build wheels for scikit-bio, hdmedians, which is required to install pyproject.toml-based projectsorPython.h: No such file or directory, according to the solution, run
sudo apt-get install python3-dev
- If you meet
UserWarning: Signature b'\x00\xd0\xcc\xcc\xcc\xcc\xcc\xcc\xfb\xbf\x00\x00\x00\x00\x00\x00' for <class 'numpy.longdouble'> does not match any known type: falling back to type probe function., according to the solution, run
conda install numpy==1.24
- If you meet
urllib3 v2.0 only supports OpenSSL 1.1.1+, currently the 'ssl' module is compiled with LibreSSL 2.8.3., according to the solution, run
conda install urllib3<2.0
- If you meet
No module named 'pexpect',No module named 'decorator', orNo module named 'cachecontrol', run
conda install scikit-bio==0.5.6
The scripts to produce the results in the paper can be found in paper_results/*, where some scripts might require additional python modules. HGT breakpoints and events detected by LocalHGT from all real samples can be seen at Detected HGTs in real data.
Shuai Wang, Yiqi Jiang, Lijia Che, Ruo Han Wang, Shuai Cheng Li, Enhancing insights into diseases through horizontal gene transfer event detection from gut microbiome, Nucleic Acids Research, 2024;, gkae515, https://doi.org/10.1093/nar/gkae515
Should you have any queries, please feel free to contact us, we will reply as soon as possible (swang66-c@my.cityu.edu.hk).