Bio::TwoBit is a Ruby interface to 2bit files.
Ruby bindings to lib2bit / py2bit.
2bit files are used to store and index DNA sequences, usually of entire reference genomes. The 2bit format is a compact binary representation of DNA sequences that is used by the UCSC Genome Browser.
gem install bio-twobitLinux and macOS are supported. Windows is currently not supported.
require 'bio/twobit'
# hg38 = Bio::TwoBit.open("hg38.2bit")
hg38 = Bio::TwoBit::Hg38.new
hg38.path
# "hg38.2bit"
hg38.info
# {"file_size"=>818064875,
# "nChroms"=>640,
# "sequence_length"=>3272116950,
# "hard_masked_length"=>161368694,
# "soft_masked_length"=>0}
hg38.chroms.take(5)
# [["chr1", 248956422],
# ["chr2", 242193529],
# ["chr3", 198295559],
# ["chr4", 190214555],
# ["chr5", 181538259]]Fetch a sequence
hg38.sequence("chr1", 50000, 50050)
# "AAACAGGTTAATCGCCACGACATAGTAGTATTTAGAGTTACTAGTAAGCC" # length 50- The first number is the (0-based) position on the chromosome/contig where the sequence should begin.
- The second number is the (1-based) position on the chromosome where the sequence should end.
hg38.bases("chr1", 10000, 10100)
# {"A"=>0.34, "C"=>0.49, "T"=>0.17, "G"=>0.0}
hg38.bases("chr1", 10000, 10100, fraction: false)
# {"A"=>34, "C"=>49, "T"=>17, "G"=>0}
hg38.bases("chr1")
# {"A"=>0.26940569141052323,
# "C"=>0.19302592242428676,
# "T"=>0.2701041550155312,
# "G"=>0.19325280952182064}
hg38.hard_masked_blocks("chr1", 0, 1000000)
# [[0, 10000], [207666, 257666], [297968, 347968], [535988, 585988]]The 2-bit file must be closed explicitly. Alternatively, you can use a block. Even if it is not closed, it will probably be closed by GC and there will be no problem. But this is not guaranteed.
# Explicitly close the file.
tb = Bio::TwoBit.open("test/fixtures/foo.2bit")
tb.close
# You can also use blocks.
Bio::TwoBit.open("test/fixtures/foo.2bit") do |t|
p t.info
endtb.closed? # true / falseIf you would like to include information about soft-masked bases, you need to specify masked: true
tb = Bio::TwoBit.open("test/fixtures/foo.2bit")
tb.sequence("chr1", 60, 72)
# => "GTAGCTAGCTGA"
tb = Bio::TwoBit.open("test/fixtures/foo.2bit", masked: true)
tb.sequence("chr1", 60, 72)
# => "GTagctagctGA"
tb.soft_masked_blocks("chr1")
# => [[62, 70]]tb.masked? # true / falseSome reference genomes are provided as classes in advance. These classes automatically download 2bit files from the UCSC site into a cache directory upon first use.
hg19 = Bio::TwoBit::Hg19.new
hg38 = Bio::TwoBit::Hg38.new
hs1 = Bio::TwoBit::Hs1.newAdding a new reference genome is easy. Add the id of the genome you want to use here.
git clone https://github.com/kojix2/bio-twobit
vi lib/bio/twobit/references/template.erb # Add your id to ids list.
ruby lib/bio/twobit/references/template.erb
rake install
If you want to use 2-bit files from locations other than UCSC, create your own classes here.
Pull requests are welcome.
Bug reports and pull requests are welcome on GitHub at https://github.com/kojix2/bio-twobit.
Do you need commit rights to my repository?
Do you want to get admin rights and take over the project?
If so, please feel free to contact us @kojix2.
The gem is available as open source under the terms of the MIT License.
Code from Red Datasets is used for automatic file download and caching. (The MIT license)